During infection, and in cancer, the immune system’s response to antigens leads to changes in the T-cell repertoire (TCR). T-cell clonal expansions can be measured by sequencing the antigen-specific loci in the T-cell receptor beta (TCRβ) gene[
In this study, whole blood specimens were collected in blood collection tubes (BCT; Streck Inc. NE) from donors previously diagnosed with non-small cell lung cancer (NSCLC)[
Whole blood was collected from 5 donors in Streck BCT®. Specimens were shipped at ambient temperature to our centralized clinical testing laboratory and processed within 4 days after blood was drawn. Whole blood was centrifuged at 800 ×
Cryopreserved PBMC, initially recovered by leukapheresis using Ficol, were thawed in X-VIVOTM 15 (Lonza, Basel, Switzerland) medium. We chose 4 different normal healthy, CMV-seropositive, and HLA-A*0201-positive donors for this study. Thawed cells were collected at baseline or cultured for 6 days in the presence of 1 µg/mL CMV whole antigen (partially purified lysate from CMV-infected human fibroblast cells) or 1 µg/mL HLA-A*0201-restricted CMV immunodominant peptide (pp65495-503, NLVPMVATV). IL-2 (10 U/mL) was added one day after the start of the culture.
For sequencing, cells were lysed using Buffer RLT Plus (Qiagen, CA) supplemented with β-mercaptoethanol and frozen at -80°C until RNA extraction. RNA was isolated according to the manufacturer’s instructions using the RNeasy-Plus® Mini Kit (Qiagen, CA).
PBMC were prepared for flow cytometry using HLA-A*0201-CMVpp65495-503 tetramer-PE reagent (MBL International, MA). Cells were incubated with HLA-A*0201-CMVpp65495-503 tetramer-PE reagent (MBL International, Woburn, MA) for 15 min at room temperature, followed by incubation with anti-human CD8a-FITC antibody (clone RPB-T8, BioLegend, San Diego, CA) at 4 °C for 30 min. 7-AAD was included in the final buffer to exclude dead cells. Data were acquired in a FACScan flow cytometer (Becton Dickinson, San Jose, CA) using BD Cell Quest software. Analyses were done using FCS Express version 4 (De Novo Software, Pasadena, CA). Percent HLA-A*0201/CMVpp65(495-503) tetramer-positive population was quantified from live (7-AAD-) CD8+ cells.
The QubitTM RNA HS assay (ThermoFisher Scientific, MA) was used to quantify RNA. Agilent RNA 6000 Nano Assay was used to determine RNA integrity number (RIN) and DV200 scores. cDNA was generated using the SuperScriptTM IV VILOTM Kit (ThermoFisher Scientific, MA). Following cDNA synthesis, the input for library preparation was determined based on a functional CD3 RNA qualification assay, which measures the CD3 fraction of mixed cell populations and cDNA amplifiability[
The Oncomine TCR Beta-SR Assay (ThermoFisher Scientific, MA) was used to sequence
The Oncomine TCR Beta-SR Assay targets the complementarity-determining region 3 (
To assess TCR repertoire features in clinical specimens, whole blood was collected from 5 different NSCLC donors in Streck RNA BCT and shipped to the centralized laboratory. RNA was isolated for TCR sequencing from the buffy coat layer, which contains a large fraction of PBLs. DV200 score, which was developed to measure the quality of highly degraded RNA from formalin-fixed paraffin-embedded (FFPE) samples for RNA-seq, was used to measure RNA quality. This method is suitable for the assessment of PBL RNA from Streck BCT, which tends to be fragmented following shipment at ambient temperature.
The input quantity used for library preparation was based on a functional CD3 RNA qualification assay, which measures both the T-cell RNA content and the amplifiable quality of the sample. As shown in
Sample characterization and TCRβ assay performance metrics for specimens from NSCLC donors
Donor | 1 | 2 | 3 | 4 | 5 |
---|---|---|---|---|---|
DV200 Score | 52% | 55% | 75% | 70% | 77% |
RNA Input (ng) | 400 | 180 | 72 | 324 | 34 |
Library Conc (pM) | 473 | 457 | 1101 | 1004 | 45 |
Raw Reads (millions) | 1.55 | 1.99 | 2.13 | 1.99 | 1.17 |
Productive and Rescued Reads (%) | 74 | 73 | 79 | 83 | 63 |
Number of Clones | 49,914 | 44,299 | 58,357 | 61,936 | 10,731 |
Clonality | 0.09 | 0.24 | 0.15 | 0.14 | 0.48 |
TCR Convergence | 0.016 | 0.021 | 0.026 | 0.033 | 0.005 |
TCRβ: T-Cell receptor beta; TCR: T-Cell receptor; NSCLC: non-small cell lung cancer
For the Oncomine TCR Beta-SR assay, T-cell repertoire metrics are reported using several precalculated outputs, including TCR Convergence and Evenness scores. For this study, Clonality was determined from the Evenness score and was defined as 1- Evenness. Scores ranged 0.005-0.033 for TCR Convergence and 0.09-0.48 for Clonality across the 5 donors
Spectratyping plots for the five NSCLC specimens. Donor 1-5 correspond to A-E, respectively. Circles are bins containing all clones with a particular
To study the TCR repertoire changes due to antigen stimulation, T-cell populations from four CMV-seropositive donors were analyzed after a 6-day
RNA was isolated from PBMC prior to antigen challenge (“Baseline”) and after stimulation and used to prepare libraries for TCR sequencing following the same workflow used for the NSCLC specimens. As shown in
Sample characterization and TCRβ assay performance metrics for CMV antigen stimulation study with specimens from normal healthy donors
Donor | Treatment | RIN score | RNA Input (ng) | Library conc (pM) | Raw reads (millions) | Productive and rescued reads (%) | # Clones |
---|---|---|---|---|---|---|---|
1 | Baseline | 10 | 46 | 593 | 1.6 | 83 | 31,804 |
Lysate | 10 | 25 | 788 | 1.99 | 85 | 12,504 | |
Peptide | 10 | 29 | 385 | 1.52 | 84 | 26,901 | |
2 | Baseline | 10 | 43 | 708 | 1.54 | 82 | 25,459 |
Lysate | 9.9 | 46 | 1,093 | 1.99 | 83 | 11,250 | |
Peptide | 10 | 107 | 687 | 2.16 | 83 | 31,367 | |
3 | Baseline | 10 | 38 | 290 | 1.45 | 81 | 29,964 |
Lysate | 10 | 48 | 630 | 1.77 | 84 | 27,647 | |
Peptide | 10 | 63 | 401 | 1.43 | 83 | 26,131 | |
4 | Baseline | 10 | 40 | 563 | 1.56 | 83 | 31,672 |
Lysate | 10 | 30 | 835 | 1.7 | 83 | 6,683 | |
Peptide | 10 | 29 | 608 | 1.78 | 84 | 36,051 |
TCRβ: T-Cell receptor beta; CMV: cytomegalovirus; RIN: RNA integrity number
TCR Convergence scores varied across donors at baseline and in response to antigen challenge, as shown in
TCRβ convergence scores for the CMV model antigen stimulation study. Results are shown for two replicate Ion 530 chips (A); Two examples of convergent T-cell clones are shown for cells stimulated with pp65 peptide from Donor 3 (B). TCRβ: T-Cell receptor beta; CMV: cytomegalovirus
Clonality scores increased in the CMV lysate condition relative to baseline for all 4 donors, and the increase was most dramatic for Donor 4
Clonality scores for the CMV model antigen study (A); Spectratyping plots for Donor 4 showing clonal expansion in the lysate condition (B) relative to baseline (C). Color indicates evenness and clonality, where darkest blue is highest evenness and lowest clonality. Size indicates Frequency for each bin containing clones of a particular
Expansion of CMVpp65(495-503)-specific T-cells post-antigen challenge was also analyzed by flow cytometry using HLA-A*0201/CMVpp65(495-503) tetramer reagent.
pp65 tetramer assay results for the CMV model antigen study. Positive FITC and PE staining indicates the presence of HLA-A*0201-restricted, pp65(495-503)-responsive CD8+ T-cells. The % positive cells are shown. CMV: cytomegalovirus; FITC: fluorescein isothiocyanate; PE: phycoerythrin
As shown in
Total reads, frequency, and rank for the TRBV12-3 TRBJ1-2 ASSSAxYxYT family of clones observed across the three treatment conditions for all donors
Donor | Condition | Variable | Joining | CDR3 AA | CDR3 NT | Total counts | Frequency | Rank |
---|---|---|---|---|---|---|---|---|
1 | Baseline | 12-3 | 1-2 | ASSSANYGYT | GCCAGCAGTTCGGCGAACTATGGCTACACC | 31 | 0.007% | 1300 |
Lysate | 12-3 | 1-2 | ASSSANYGYT | GCCAGCAGTTCGGCTAACTATGGCTACACC | 123 | 0.010% | 470 | |
Peptide | 12-3 | 1-2 | ASSSANYGYT | GCCAGCAGTTCGGCTAACTATGGCTACACC | 4003 | 0.85% | 8 | |
2 | Baseline | 12-3 | 1-2 | ASSSAHYGYT | GCCAGCAGTTCCGCTCACTATGGCTACACC | 25 | 0.004% | 2379 |
Lysate | 12-3 | 1-2 | ASSSAHYGYT | GCCAGCAGTTCCGCTCACTATGGCTACACC | 151 | 0.012% | 426 | |
Peptide | 12-3 | 1-2 | ASSSAHYGYT | GCCAGCAGTTCCGCTCACTATGGCTACACC | 30031 | 3.0%, | 3 | |
2 | Baseline | 12-3 | 1-2 | ASSSANYRYT | GCCAGCAGTTCGGCTAACTATCGCTACACC | 74 | 0.012% | 639 |
Lysate | 12-3 | 1-2 | ASSSANYRYT | GCCAGCAGTTCGGCTAACTATCGCTACACC | 1528 | 0.12% | 80 | |
Peptide | 12-3 | 1-2 | ASSSANYRYT | GCCAGCAGTTCGGCTAACTATCGCTACACC | 150381 | 15.1% | 1 | |
3 | Lysate | 12-3 | 1-2 | ASSSAYYGYT | GCCAGCAGCTCAGCGTACTATGGCTACACC | 96 | 0.012% | 455 |
Peptide | 12-3 | 1-2 | ASSSAYYGYT | GCCAGCAGCTCAGCGTACTATGGCTACACC | 19545 | 3.6% | 3 | |
4 | Baseline | 12-3 | 1-2 | ASSSANYGYT | GCCAGCAGTTCAGCTAACTATGGCTACACC | 489 | 0.080% | 54 |
Lysate | 12-3 | 1-2 | ASSSANYGYT | GCCAGCAGTTCAGCTAACTATGGCTACACC | 6061 | 0.52% | 8 | |
Peptide | 12-3 | 1-2 | ASSSANYGYT | GCCAGCAGTTCAGCTAACTATGGCTACACC | 485 | 0.075% | 85 |
T-cell clone dynamics as measured by the TCR Beta assay correlate with changes in the pp65-responsive CD8+ T-cell population as measured by flow cytometry. The fold change in clone frequency for the ASSSAxYxYT family of clones in response to CMV lysate challenge is plotted relative to the fold increase in % pp65-responsive CD8+ cells in response to CMV lysate challenge for all four donors. Blue dotted line: linear regression analysis. The coefficient of determination (R2) for the correlation is shown. TCR: T-Cell receptor; CMV: cytomegalovirus
These studies demonstrate that the Oncomine TCRβ assay can detect clonal repertoire features as well as T-cell expansion in response to antigen stimulation with high resolution using PBL isolated from whole blood specimens.
Currently, there is no
Using NSCLC donors, we demonstrated that T-cell profiling can successfully be performed using the buffy coat layer of whole blood collected in cell-free preservative-containing BCT [
Profiling of the TCRβ repertoire using the Ion GeneStudio S5 platform represents a valuable new solution that benefits from the high accuracy (low substitution error rate) of a semiconductor-based sequencing approach; a noteworthy characteristic considering that substitution errors can mimic TCR convergence[
We are currently pursuing studies to further evaluate the clinical utility of sequencing the T-cell immune repertoire in NSCLC patients receiving immunotherapy. An example of one such ongoing study is of NSCLC patients with positive PD-L1 IHC results that are eligible for treatment with immunotherapy[
We thank members of the Thermo Fisher Scientific team, particularly Dr. Timothy Looney for critical discussions and Emma Longshore (Biodesix Inc.) for assistance with editing.
Study design, execution, analysis, review: Jackson LP, Tjoa BA
Study design, editing, review: Mellert H, Pestano GA
Not applicable.
None.
Jackson L, Mellert H and Pestano GA are employees of Biodesix, Inc. Tjoa BA is an employee of Cellero, LLC.
The specimens used in our study were Institutional Review Board waived as they were remnant, de-identified specimens.
Not applicable.
© The Author(s) 2020.